circad | circRNAs associated with diseases

hsa_circ_0007534
Gene	DDX42	Organism	Human
Genome Locus	chr17:61869771-61877977:+	Build	hg19
Disease	osteosarcoma	ICD-10	Malignant neoplasm of bone and articular cartilage of other and unspecified sites (C41)
DBLink	Link to database	PMID	30142548
Experimental Method
Sample Type	Tissues and Cell lines	Comparison	57 pairs of OS tissue specimens and corresponding normal tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GTGACGGAAATCCAATTGCACC Reverse ATGGAATTGCTGGCG AGTTG	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Li, B, Li, X (2018). Overexpression of hsa_circ_0007534 predicts unfavorable prognosis for osteosarcoma and regulates cell growth and apoptosis by affecting AKT/GSK-3β signaling pathway. Biomed. Pharmacother., 107:860-866.